STR Motif Explorer

This section helps you understand the internal structure of each STR marker along the HG38 reference sequence, over the ISFG minimum range. It shows that not every locus is a continuous run of its canonical motif, and highlights the complexity of compound and interrupted loci.

Configuration

STR marker

Pick a marker to see its reference sequence over the ISFG minimum range and its canonical repeat motif.

Naming note: STRNaming and the ISFG recommendations report the repeat structure over the minimum range. Older 2016 bracketing was often defined over a wider window (STRbase / NIST), so the two can look different for the same allele.

Source: STRidER / FSSG v6.1 (beta)Open STRidER

Structure of CSF1PO

CE equivalent: 13ISFG minimum rangechr5:150,076,318-150,076,380 (63 bp)Strand: -

STRNaming Formatted ISFG Minimum Range for Common Alleles (2024 onward)

TCTA_[n]

GRCh38 Historical bracketing (2016-2023)

[ATCT]13

Reference sequence (ISFG minimum range)

CTTCCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTAATCT

Repeat unitaaSecondary repeat (lowercase)Interruption / internal variantFlanking regionMotif unit in flanking region, excluded from allele calling.

The sequence structure (repeat, interruption, flank) follows STRidER's Forensic Sequence Structure Guide (FSSG v6.1); the ISFG / STRNaming name above is a complementary view, not a re-implementation of the naming rules. This section will be updated as STRidER and the official ISFG nomenclature guidance are revised.

MPS kits usually sequence a wider window than the ISFG minimum range, so the same allele can look longer or shorter in raw kit output while its STRNaming name stays comparable.