STR Motif Explorer

This section helps you understand the internal structure of each STR marker along the GRCh38 reference sequence, over the ISFG minimum range. It shows that not every locus is a continuous run of a single repeat motif, and highlights the complexity of compound and interrupted loci.

Configuration

STR marker

Pick a marker to see the STRNaming name of its GRCh38 reference allele, its sequence over the ISFG minimum range, and STRidER's templates for common alleles.

Naming note: names generated with STRNaming follow the 2024 ISFG recommendations (Gettings et al. 2024) and describe the ISFG minimum range. For some loci the historical 2016-2023 bracketing in the FSSG reads the repeats from a different starting base, so the two can look different for the same allele.

Source: FSSG v6.1 (STRidER; distributed as FSSG_v6-1_beta.xlsx)Open STRidER

Structure of CSF1PO

CE equivalent: 13ISFG minimum rangechr5:150,076,318-150,076,380 (63 bp)

Reference allele (GRCh38) named with STRNaming 1.2.1

CE13_TCTA[13]

Reference sequence (ISFG minimum range, GRCh38 forward strand)

CTTCCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTAATCT

Hover over or tap a block of the name or the sequence: it lights up in both.

STRNaming Formatted ISFG Minimum Range for Common Alleles (2024 onward)

Structures of common alleles in populations, written relative to GRCh38; the one the reference allele follows is marked. [n] is a count that varies between alleles; a suffix such as -4C>T is a flanking difference from GRCh38.

TCTA_[n]reference allele

GRCh38 Historical bracketing (2016-2023)

[ATCT]13

Same bases as the sequence above, written in one fixed repeat phase; lowercase letters mark bases outside the main repeat units. STRNaming can change phase and has no interruptions, so the two can look very different for the same allele.

Sources and notes

STRidER's template for the common alleles of this locus, as written in the FSSG. [n] marks a block whose repeat count varies between alleles. It is not an allele name: a full STRNaming name starts with the CE allele (for example CE13_) and gives the count of every block, as in the reference allele below.

STRNaming 1.2.1 name of the GRCh38 reference sequence over the ISFG minimum range; its CE equals the FSSG CE equivalent. Its structure follows the template above.

Blocks and counts are those of the STRNaming 1.2.1 name of the reference allele shown above; the rest of the ISFG minimum range is flank. This repeat region is exactly the one STRidER marks in the FSSG row "STRNaming Bracketing of ISFG Minimum Range".

This section is kept up to date with new releases of the FSSG and STRNaming.

Many MPS kits sequence a wider window than the ISFG minimum range, but not all of them cover it completely, so compare each kit range with the minimum range. Raw kit output can look longer or shorter, while names over the minimum range stay comparable.